Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.042692 |
Chromosome: | chromosome 6 |
Location: | 5646444 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g287700 | STK18,STPK18 | Serine/threonine protein kinase; (1 of 18) 2.7.10.2//2.7.11.1 - Non-specific protein-tyrosine kinase / Cytoplasmic protein tyrosine kinase // Non-specific serine/threonine protein kinase / Threonine-specific protein kinase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGCTTGAGAGGGTGCGCTAGCAACCGCGGGTTGCTTGTAACGTCGGTG |
Internal bar code: | CTATCAAAGCGATGTGGTCAGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 994 |
LEAP-Seq percent confirming: | 52.9412 |
LEAP-Seq n confirming: | 9 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGGTCGTGAAGCAATTTGC |
Suggested primer 2: | CCACCATGAACAGCAACAGC |