| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.042735 |
| Chromosome: | chromosome 2 |
| Location: | 3887602 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g101550 | MRS1 | BTB/POZ domain protein; (1 of 25) IPR000210//IPR011333 - BTB/POZ domain // POZ domain | CDS/intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGTGGGGTCACGAATCATCCTGCTCCCGACGTAGGGCTCATCGCCGTCC |
| Internal bar code: | GTGTGGTATTAGCGAGGGGCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2590 |
| LEAP-Seq percent confirming: | 56.1404 |
| LEAP-Seq n confirming: | 32 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 57 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCCATCTCAAACGAGGCCA |
| Suggested primer 2: | GTCGCATTTGCCTTCGATCC |