| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.042739 |
| Chromosome: | chromosome 7 |
| Location: | 861139 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g318551 | CYA8 | Adenylate cyclase; (1 of 1) PF00211//PF13855 - Adenylate and Guanylate cyclase catalytic domain (Guanylate_cyc) // Leucine rich repeat (LRR_8) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACGCTCTCCCTCCCCCTTCGTACCTGGCTACGACTTCACTTCGTAAAC |
| Internal bar code: | CAGAGTACAATCAGGTGGCATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 724 |
| LEAP-Seq percent confirming: | 85.1852 |
| LEAP-Seq n confirming: | 23 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAGAGGTCGCATCATGGGG |
| Suggested primer 2: | ACGTGCTGGTGTTCTACGAG |