| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.042749 |
| Chromosome: | chromosome 10 |
| Location: | 6231379 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g463150 | DCI1 | Enoyl-CoA hydratase/isomerase family; (1 of 1) PTHR11941//PTHR11941:SF43 - ENOYL-COA HYDRATASE-RELATED // DELTA(3,5)-DELTA(2,4)-DIENOYL-COA ISOMERASE, MITOCHONDRIAL | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTCCACGTAATGAAGGGTTGGGCCGCTCGCGTACTCTTACCCTAGGGAA |
| Internal bar code: | TTGGGATGATACTAATTATGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2040 |
| LEAP-Seq percent confirming: | 90.6977 |
| LEAP-Seq n confirming: | 39 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAGGACAACCGTGAACAAC |
| Suggested primer 2: | CAGTAGTGGCCCTGTGACTG |