Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.042880 |
Chromosome: | chromosome 16 |
Location: | 6348133 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g675700 | BLZ21 | (1 of 2) IPR000104//IPR004827 - Antifreeze protein, type I // Basic-leucine zipper domain; bZIP transcription factor | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCGCCGGCTTCTGATGTCCTGGTTTCTTGGCGTTGCCGCATACTCGCA |
Internal bar code: | AAGCGGCTGCCATAGCCGTTTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1876 |
LEAP-Seq percent confirming: | 63.6364 |
LEAP-Seq n confirming: | 7 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCTTGCTTGTCGTCAAACA |
Suggested primer 2: | CTCACTTGCTGCACACACAC |