| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.042907 |
| Chromosome: | chromosome 5 |
| Location: | 3564274 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g233850 | (1 of 3) IPR007751//IPR029058 - Domain of unknown function DUF676, lipase-like // Alpha/Beta hydrolase fold | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATCAGCATTCGTTCAGGCGAAGACCCTCGACAGTCTGACTAGCCTCGCT |
| Internal bar code: | ATGGTTTAACCTCCCTAACGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1605 |
| LEAP-Seq percent confirming: | 53.3333 |
| LEAP-Seq n confirming: | 16 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCCTTTGCCGCTTACTCCT |
| Suggested primer 2: | GTTCAGAGACCTGGCTCACC |