Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.042927 |
Chromosome: | chromosome 3 |
Location: | 5606696 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g185750 | (1 of 1) IPR003613//IPR013083 - U box domain // Zinc finger, RING/FYVE/PHD-type | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTGAGGAGCTGGAGCCCGATGACAACGGCCACTATGCCTACGCGCCGG |
Internal bar code: | TTCATTGAGACTTTCACTTGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1409 |
LEAP-Seq percent confirming: | 81.9444 |
LEAP-Seq n confirming: | 59 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 72 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCAAATGTCCGCACTCACTG |
Suggested primer 2: | CCCCTTCCTTTCCAGCTGAG |