| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.042938 |
| Chromosome: | chromosome 5 |
| Location: | 156567 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g242500 | PF1,RSP4 | (1 of 2) PF04712 - Radial spokehead-like protein (Radial_spoke); Radial spoke protein 4 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGCTACGAAGTGGAAGCATGCTCCAACACTTCTCAGTGGTCCCCTGAG |
| Internal bar code: | TCACTTTGAGTTAGGCGTCAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1348 |
| LEAP-Seq percent confirming: | 93.3333 |
| LEAP-Seq n confirming: | 28 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACCTCCTGGAGACATCCCT |
| Suggested primer 2: | TCTTGAAGGCCACCTCGAAC |