| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.042989 |
| Chromosome: | chromosome 9 |
| Location: | 1535555 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g399300 | FKB17A,FKB17-1,FKB14 | Peptidyl-prolyl cis-trans isomerase, FKBP-type; (1 of 2) PTHR10516//PTHR10516:SF308 - PEPTIDYL-PROLYL CIS-TRANS ISOMERASE // PEPTIDYL-PROLYL CIS-TRANS ISOMERASE FKBP17-2, CHLOROPLASTIC-RELATED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGATTCAATAACGGCACTACCACTGATACCAAAATGAGCAATCTTACTGG |
| Internal bar code: | TGTCGGGGATCAGCAAAGCTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1005 |
| LEAP-Seq percent confirming: | 94.1176 |
| LEAP-Seq n confirming: | 16 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACCGTACACAACACCCACG |
| Suggested primer 2: | TTCAGACTCCACGTGCTTCC |