| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.043041 |
| Chromosome: | chromosome 8 |
| Location: | 1226438 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g363300 | (1 of 1) 2.4.2.1//2.4.2.28 - Purine-nucleoside phosphorylase / PNPase // S-methyl-5'-thioadenosine phosphorylase / MTAPase | CDS | |
| Cre08.g363350 | (1 of 2) IPR003034//IPR009061 - SAP domain // Putative DNA-binding domain | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGATTCGCGGTGCCACCTCGCCTTCCTGTGACGCGGTTGCACGCATAAGA |
| Internal bar code: | TTGGTGGTGCGGGAAGGACGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2434 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 41 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGAACTCCAGAAGCCAGGG |
| Suggested primer 2: | GAGGAAGTCAAGAGGCACCC |