| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.043181 |
| Chromosome: | chromosome 1 |
| Location: | 5840537 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g800102 | (1 of 1) K01411 - nardilysin [EC:3.4.24.61] (NRD1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATGCAAGTCCCGCCTCTCCTCCCCTCTCCCCTGTCCCTGCCTCCCCCCC |
| Internal bar code: | GCTTTCGGGGCATTGAATGGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 111 |
| LEAP-Seq percent confirming: | 13.8889 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 31 |
| LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGTGTGGTGGGGGTATGTG |
| Suggested primer 2: | GGATGATGAGGATGAGGGCG |