| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.043217 |
| Chromosome: | chromosome 17 |
| Location: | 5613472 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g739900 | (1 of 1) IPR012337//IPR027417 - Ribonuclease H-like domain // P-loop containing nucleoside triphosphate hydrolase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGATAACAAGCGTGCTGACGTCCCTCCTTGCTGCTGGTCGGCTCCCCCTG |
| Internal bar code: | GTTTTAGCTTCCTCGTGGTAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3437 |
| LEAP-Seq percent confirming: | 92.381 |
| LEAP-Seq n confirming: | 97 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 105 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAATATCACACAGCAGGCG |
| Suggested primer 2: | TCGTGTCACAGGTGCAATCA |