| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.043269 |
| Chromosome: | chromosome 10 |
| Location: | 6463511 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g464950 | (1 of 1) K15201 - general transcription factor 3C polypeptide 3 (transcription factor C subunit 4) (GTP3C3, TFC4) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATAAAGAAGTGAAGGCTTGGGGGGGATGCAATGGCGTACGGGATCAAGT |
| Internal bar code: | CTACAACAATATTGGGAAGGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 235 |
| LEAP-Seq percent confirming: | 37.5 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGAAGTGAAGTGCCGACGT |
| Suggested primer 2: | CGGCGGATCTGAAGACAGTT |