Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.043319 |
Chromosome: | chromosome 16 |
Location: | 2086529 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g657450 | MPA12 | Metallophosphoesterase/metallo-dependent phosphatase; (1 of 1) 3.6.1.13//3.6.1.16//3.6.1.53 - ADP-ribose diphosphatase / ADPR-PPase // CDP-glycerol diphosphatase / CDP-glycerol pyrophosphatase // Mn(2+)-dependent ADP-ribose/CDP-alcohol diphosphatase / Mn(2+)-dependent ADP-ribose/CDP-alcohol pyrophosphatase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACACACCGCCTGTGCAGGGGCCTAGACTGGCGCAACGCCTACCCCTTCC |
Internal bar code: | ACTCGGCCTCGTAGGGCCTTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1147 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 33 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACACACACACATGCACATGC |
Suggested primer 2: | CCCTCGCAAAACTCGCAAAA |