| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.043420 |
| Chromosome: | chromosome 12 |
| Location: | 3441132 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g497500 | SNE7 | (1 of 8) PTHR10366:SF411 - HIGH CHLOROPHYLL FLUORESCENCE PHENOTYPE 173 PROTEIN; Cinnamoyl-CoA reductase/flavanone 4-reductase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGTGCCGACCCATGGCTGGACAGAAGCAAGCCGGGGCACCCGTATTGG |
| Internal bar code: | ATAAGTGGTTTAGGCGGTCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3977 |
| LEAP-Seq percent confirming: | 7.52688 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 86 |
| LEAP-Seq n unique pos: | 93 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGAAAAGGGTTTGGTGGCA |
| Suggested primer 2: | AAAGGTCTGCGTCACTGGAG |