Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.043464 |
Chromosome: | chromosome 13 |
Location: | 2448540 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g579598 | SSS3B,SSS3 | (1 of 2) PTHR12526//PTHR12526:SF341 - GLYCOSYLTRANSFERASE // SUBFAMILY NOT NAMED; Soluble starch synthase III | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCAACACTAACTCACAAAACTCACACCCCACACACACACCTGCCAACAG |
Internal bar code: | CCTTATTCCAATACCATGGGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 169 |
LEAP-Seq percent confirming: | 33.3333 |
LEAP-Seq n confirming: | 3 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACAGGATGCACTGAACTGGG |
Suggested primer 2: | GACTTTGGAGGGGAGGTTGG |