| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.043474 |
| Chromosome: | chromosome 17 |
| Location: | 311488 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g802023 | (1 of 1) IPR012337//IPR013103 - Ribonuclease H-like domain // Reverse transcriptase, RNA-dependent DNA polymerase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGCGGCGCTACGTCAACGAGCTGCTGCAGCGACACGGCATGGCTGATG |
| Internal bar code: | AATTCTATAGCTATCGGACTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4374 |
| LEAP-Seq percent confirming: | 51.3889 |
| LEAP-Seq n confirming: | 37 |
| LEAP-Seq n nonconfirming: | 35 |
| LEAP-Seq n unique pos: | 72 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCTGGATGTCGATGTGCTT |
| Suggested primer 2: | AAAGCAGAGAGGACGAGCAC |