| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.043475 |
| Chromosome: | chromosome 14 |
| Location: | 1469814 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g617300 | PSL3 | (1 of 1) PTHR12174//PTHR12174:SF42 - SIGNAL PEPTIDE PEPTIDASE // SUBFAMILY NOT NAMED; Signal peptide peptidase-like protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTCTGCAAACCATGCGCGGAGCACCTGACATGGATTTCGGGCGCCGGCA |
| Internal bar code: | TCGAGTGGGGGTTTAGGTTGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1403 |
| LEAP-Seq percent confirming: | 61.5385 |
| LEAP-Seq n confirming: | 16 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTCCTAGACCAAGGGCGAT |
| Suggested primer 2: | TCATCACCCTAGTCATGCGC |