| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.043549 |
| Chromosome: | chromosome 17 |
| Location: | 3706277 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g725950 | CSR13 | (1 of 3) K08106 - N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase (CHST15); Carbohydrate sulfotransferase-related 13 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCTCTGCCTCTCCGACCGCAACTCAACACCCACATAGGTCCAGACTGA |
| Internal bar code: | TGACCATTGTGAGATGTACATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 521 |
| LEAP-Seq percent confirming: | 92.8571 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTCACTGCCCGGTTTAGTT |
| Suggested primer 2: | GGACGTGAGAAGGGGAAGTG |