Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.043570 |
Chromosome: | chromosome 7 |
Location: | 2392944 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g328600 | (1 of 1) K11804 - WD repeat-containing protein 42A (WDR42A) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAACTGCACAAGCCCGGCTCCCGGCTTCCACACACTGCGGCCGCATCAAT |
Internal bar code: | GGTCCTTAACGCTAGGTACGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1374 |
LEAP-Seq percent confirming: | 53.3333 |
LEAP-Seq n confirming: | 8 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTGGCCTGAAGAGGTACAC |
Suggested primer 2: | GCGACGTGTGCTTTTTCGAT |