| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.043645 |
| Chromosome: | chromosome 14 |
| Location: | 4053056 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g633400 | PGA7 | (1 of 14) PF14259 - RNA recognition motif (a.k.a. RRM, RBD, or RNP domain) (RRM_6); Putative phospholipid/glycerol acyltransferase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCCGTGGCGGTGGCGATGCGGCCGCGCCGGCCCACACACAGCCCGCCA |
| Internal bar code: | GGTTATTGCTTGCAAGTCCACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1120 |
| LEAP-Seq percent confirming: | 83.3333 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTAGGTGAACGCCTGACCC |
| Suggested primer 2: | GCCTCTGCCACAGACATCTT |