| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.043688 |
| Chromosome: | chromosome 1 |
| Location: | 7191138 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g051550 | HEL8,SSA9,HEL9 | (1 of 1) PTHR18934:SF148 - ATP-DEPENDENT RNA HELICASE DHX34-RELATED; DEAD/DEAH box helicase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCAACTTGTTTGACGGATTTGGCCTCACGTGCGCCTAAAAGTCTACAA |
| Internal bar code: | ACGCTCCGAGGAAAACCAACAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2282 |
| LEAP-Seq percent confirming: | 71.4286 |
| LEAP-Seq n confirming: | 55 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 77 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCGTCTAGCTAGTCGTGCC |
| Suggested primer 2: | GGCTAATCCATCCCTCCTGC |