| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.043715 |
| Chromosome: | chromosome 11 |
| Location: | 3666145 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g478456 | (1 of 45) IPR029052 - Metallo-dependent phosphatase-like | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCGATGTAACCAAAGCCTGGCGAACCCGATACCGTAATGCCGCAAGCTG |
| Internal bar code: | TCGTTAAAATGCACATTACTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 724 |
| LEAP-Seq percent confirming: | 91.6667 |
| LEAP-Seq n confirming: | 22 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACGGCCGCATTCACATATG |
| Suggested primer 2: | GCGGAGGACACAGACAATGA |