| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.043831 |
| Chromosome: | chromosome 7 |
| Location: | 2438717 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g329050 | NCD7,AOC5 | Cationic amino acid transporter; (1 of 2) K03294 - basic amino acid/polyamine antiporter, APA family (TC.APA) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCATGCTTCATATATCACAAAACGGCGAGTCGATTTGTGTTCGCGTGTC |
| Internal bar code: | GGCAGCTAGGAGAAAAGATCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3501 |
| LEAP-Seq percent confirming: | 98.0769 |
| LEAP-Seq n confirming: | 102 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 104 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACTCATTCAGCCAGCTCCA |
| Suggested primer 2: | TCACGGGGAGAAGAAAACGG |