Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.043861 |
Chromosome: | chromosome 1 |
Location: | 4835246 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g800091 | (1 of 1) K18663 - activating signal cointegrator complex subunit 3 [EC:3.6.4.12] (ASCC3) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGTCGGGGCTGTGAAGACCCAGGAGGCAAGGATGCTAGAAACCCATCAC |
Internal bar code: | TATCCAAGGCTGCATAAAATGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 99 |
LEAP-Seq percent confirming: | 37.5 |
LEAP-Seq n confirming: | 6 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATCCTCCTCCTCCTCCTCC |
Suggested primer 2: | GATGTGAAACTCGCCGATGC |