Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.043936 |
Chromosome: | chromosome 2 |
Location: | 5643837 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g115600 | MSC7 | Predicted protein with mechanosensitive ion channel domain; (1 of 1) IPR002048//IPR006685//IPR010920//IPR020568 - EF-hand domain // Mechanosensitive ion channel MscS // LSM domain // Ribosomal protein S5 domain 2-type fold | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTGGGGGGCCGGGGCACGCGGGCGGGGCTGTATTCACTGTGTGATTTG |
Internal bar code: | CGTCTGCTCGCGTCAGAGGCGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3959 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 26 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACTTGTACCTGCGGGGATG |
Suggested primer 2: | GATCTTGGTTCAGCAGGCCT |