Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.043949 |
Chromosome: | chromosome 17 |
Location: | 5064100 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g736300 | (1 of 1) IPR000104//IPR011047//IPR018391 - Antifreeze protein, type I // Quinonprotein alcohol dehydrogenase-like superfamily // Pyrrolo-quinoline quinone beta-propeller repeat | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTAGCATTGGCCACCAGCCGCCACCTCGACAACGTGTGGGCATGGGTG |
Internal bar code: | GAAGGTGCCTTCGGGACACTAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 387 |
LEAP-Seq percent confirming: | 5.26316 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 18 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTGACCATGCCCAACTACC |
Suggested primer 2: | CAGAGGATCGCGACCTGTAC |