Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.044050 |
Chromosome: | chromosome 2 |
Location: | 48344 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g073200 | THD1 | putative threonine dehydratase and component psaA trans-splicing sub complex II; (1 of 1) K01754 - threonine dehydratase (E4.3.1.19, ilvA, tdcB) | 5'UTR |
Cre02.g073250 | (1 of 1) PTHR11477:SF17 - PROTEIN PARTNER OF SNF | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTAATACTCTGCGCGGATGCAACGTGGAGCGGACTGAATTTCAGATACC |
Internal bar code: | TGCTTATAAGTCATGTGGAGAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4012 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 27 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAACTCTGACGAAGGGGCTG |
Suggested primer 2: | GGACGGGCCAAACTTACTGA |