| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.044056 |
| Chromosome: | chromosome 3 |
| Location: | 1862422 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g154600 | (1 of 2) PTHR35514:SF1 - THYLAKOID LUMENAL 15.0 KDA PROTEIN 2, CHLOROPLASTIC | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCCGCCCCAACGCGCCACGATTGGCTGGCGCGCGCGCTTGTCGACGGA |
| Internal bar code: | CTAGGACGTAGTAGAACACGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1416 |
| LEAP-Seq percent confirming: | 92.6829 |
| LEAP-Seq n confirming: | 38 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGGGTGGAATGTGATGTCG |
| Suggested primer 2: | TGTGCTTGTGTCGTGTCGTA |