| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.044087 |
| Chromosome: | chromosome 3 |
| Location: | 809250 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g146267 | (1 of 2) IPR000571//IPR002110//IPR020683 - Zinc finger, CCCH-type // Ankyrin repeat // Ankyrin repeat-containing domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGAGCCCCAGCTGCTCCTAACACGCCCTAGCAGCTCTGCAGCGCGCCGC |
| Internal bar code: | AGTTGGTCTGGGTGCAAGTTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 820 |
| LEAP-Seq percent confirming: | 28.5714 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGTCAGCTCCTCAATGCA |
| Suggested primer 2: | TAAGTCACGTGTCCACAGGC |