| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.044106 |
| Chromosome: | chromosome 9 |
| Location: | 4941019 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g403293 | FCL1 | (1 of 1) 6.3.3.2 - 5-formyltetrahydrofolate cyclo-ligase / Methenyl-THF synthetase; 5-Formyltetrahydrofolate cycloligase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGGAGCAAATGGCCGACGAGAGTAAGTGCGAAGTTGCGATATGCACCAA |
| Internal bar code: | TGAAGGCTCGATAAATACCCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 648 |
| LEAP-Seq percent confirming: | 62.5 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCCCAAACTAAAGCGGGGG |
| Suggested primer 2: | CGACCGTGTGAGACTGTTGA |