| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.044117 |
| Chromosome: | chromosome 2 |
| Location: | 7665673 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g147450 | (1 of 5) K14347 - solute carrier family 10 (sodium/bile acid cotransporter), member 7 (SLC10A7, P7) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGATCACGGACCTTTTGATCAAGCTGGCCATCACGGTGCTGGTTCCCTTC |
| Internal bar code: | TTTTTCCTCTTGTTTATCTGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2681 |
| LEAP-Seq percent confirming: | 97.7778 |
| LEAP-Seq n confirming: | 44 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 45 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCTCGTCGTATCCCAATCA |
| Suggested primer 2: | AACCTCGGTACAACGCCTTT |