| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.044177 |
| Chromosome: | chromosome 12 |
| Location: | 8894186 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g545950 | MAPKKK9 | (1 of 19) IPR000104//IPR000719//IPR001245//IPR002290//IPR011009//IPR020635 - Antifreeze protein, type I // Protein kinase domain // Serine-threonine/tyrosine-protein kinase catalytic domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // Tyrosine-protein kinase, catalytic domain; Mitogen-Activated Protein Kinase Kinase Kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTAGCTACAACAGGACGGCATGCGTGCTAAGCTGCAAACCCCCCACACCG |
| Internal bar code: | AGGATGCGAAAGGTGCATTGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1042 |
| LEAP-Seq percent confirming: | 90.9091 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCAGGGGGAAAGTACATCA |
| Suggested primer 2: | CAGGCATATCAGTCCCGACC |