Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.044190 |
Chromosome: | chromosome 13 |
Location: | 3348720 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g586450 | NAT31 | N-acetyltransferase; (1 of 5) PF13508 - Acetyltransferase (GNAT) domain (Acetyltransf_7) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCTACTCGGACTTGCTCCGCACCAGCTTCTCCGCACTGCTTCGACACC |
Internal bar code: | CCCTCTCGACTGCATGGGTTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2918 |
LEAP-Seq percent confirming: | 98.4375 |
LEAP-Seq n confirming: | 63 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 64 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGATGCTTCACTCACATGCG |
Suggested primer 2: | AACGCGGTTGTTTCAAGCTC |