| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.044215 |
| Chromosome: | chromosome 6 |
| Location: | 7976098 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g304550 | PAN2,PAR1 | (1 of 1) K12571 - PAB-dependent poly(A)-specific ribonuclease subunit 2 (PAN2); Poly(A)-ribonuclease | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGCACTGGAGCTTTCGGCAGCCTGGAAATGCATACGGTACGCCGTCAT |
| Internal bar code: | GCGACGGGTGTGGCTTGGACGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 75 |
| LEAP-Seq percent confirming: | 64.2857 |
| LEAP-Seq n confirming: | 9 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCTTTGCCGCATCTCACAT |
| Suggested primer 2: | GCTTAGGAGAGGACAGGGGA |