| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.044241 |
| Chromosome: | chromosome 3 |
| Location: | 606646 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g145447 | TTLL3,TTLL8 | Tubulin monoglycylase; (1 of 1) K16608 - tubulin monoglycylase TTLL3/8 [EC:6.3.2.-] (TTLL3_8) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTTCCCGCTGCCGCCGTCCGAGCTGTTGCCGGCGCTGGCGCCCCCTACC |
| Internal bar code: | CTTGTCGCATTTCCTTAGTTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1045 |
| LEAP-Seq percent confirming: | 68.9655 |
| LEAP-Seq n confirming: | 40 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 58 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGTATGTTTGTTTGCCCGG |
| Suggested primer 2: | CGGGCACTTAGGTCCTTGTT |