| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.044247 |
| Chromosome: | chromosome 15 |
| Location: | 1744345 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre19.g751197 | (1 of 1) K14794 - ribosomal RNA-processing protein 12 (RRP12) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATACCGCTACGCAGTACCCCGGCTTGCCCCGACCCCCGTAAACGGGAAG |
| Internal bar code: | TACATATGTATTTGCAACTCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1822 |
| LEAP-Seq percent confirming: | 67.6471 |
| LEAP-Seq n confirming: | 23 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCGCAGTACAACTTGCAAA |
| Suggested primer 2: | GTACACACACACACACACGC |