| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.044292 |
| Chromosome: | chromosome 10 |
| Location: | 1719461 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g430050 | UBC20 | E2 Ubiquitin conjugating enzyme; (1 of 1) K10583 - ubiquitin-conjugating enzyme E2 S (UBE2S, E2EPF) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCTGGACCTGACTGCTGGTCCGCAATCCTCCCAGCAGGCATGTTCCGCA |
| Internal bar code: | TCACCGATCTTTTCGCTGACGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3705 |
| LEAP-Seq percent confirming: | 98.9474 |
| LEAP-Seq n confirming: | 188 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 190 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAAGTAAACGCCGCAGACA |
| Suggested primer 2: | GCCGCACCAATAGCATTCTG |