| Insertion cassette: | CIB2 | 
| Side of cassette: | 5' | 
| Strand: | - | 
| Strain: | CLIP2.044304 | 
| Chromosome: | chromosome 15 | 
| Location: | 1617421 | 
| Confidence (%): | 80 | 
| Locus systematic id | Locus common name | Defline | Feature | 
|---|---|---|---|
| Cre19.g750547 | NDA2 | thylakoid NADH dehydrogenase; (1 of 3) K17871 - NADH:ubiquinone reductase (non-electrogenic) (ndh1) | intron | 
| Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCCCAACCCCCAGAACTCGTGTACAAAACTCACGTCCTTGACCAGGTT | 
| Internal bar code: | GCAGTATGTGGCATGGCATTGA | 
| Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 333 | 
| LEAP-Seq percent confirming: | 16.4835 | 
| LEAP-Seq n confirming: | 15 | 
| LEAP-Seq n nonconfirming: | 76 | 
| LEAP-Seq n unique pos: | 91 | 
| Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAAGGTGGGAGGAGGGATGG | 
| Suggested primer 2: | CGACTGTTGAGGACCAGCTT |