| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.044384 |
| Chromosome: | chromosome 1 |
| Location: | 6305782 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g044800 | DGAT1,PFL1 | (1 of 1) 2.3.1.54 - Formate C-acetyltransferase / Pyruvate formate-lyase; Pyruvate-formate lyase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGTAGGTGTCCAGGAAGGCGTCGATGCGGCCCAGGCTCATGGCGGCGCC |
| Internal bar code: | TCGGGTCCGCCTCTTGGCCGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3237 |
| LEAP-Seq percent confirming: | 83.3333 |
| LEAP-Seq n confirming: | 40 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 48 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGGAGTCGTACGGCTACAC |
| Suggested primer 2: | AGTACTGCATGTCCTTGCCC |