Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.044391 |
Chromosome: | chromosome 16 |
Location: | 7544224 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g683147 | (1 of 44) IPR000048 - IQ motif, EF-hand binding site | 5'UTR | |
Cre16.g683259 | MCP29 | (1 of 1) PTHR24089:SF270 - SOLUTE CARRIER FAMILY 25 MEMBER 48; Mitochondrial substrate carrier protein | outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAGGACAGGAAACGAAGGCTTGACTGCCCGAGCCTGTTTTTCATAAGTT |
Internal bar code: | TCTCTCTGCAGACATGCTCGAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1789 |
LEAP-Seq percent confirming: | 66.6667 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTTTGGGGATGTCACGAGA |
Suggested primer 2: | TGGCTGACTGTACTGAAGCG |