Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.044475 |
Chromosome: | chromosome 17 |
Location: | 2349826 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g713750 | STPK16,STK16 | (1 of 1) 2.7.10.2//2.7.11.1//2.7.11.25 - Non-specific protein-tyrosine kinase / Cytoplasmic protein tyrosine kinase // Non-specific serine/threonine protein kinase / Threonine-specific protein kinase // Mitogen-activated protein kinase kinase kinase / MLTK; Serine/threonine protein kinase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGGAGTGAGGGGCTAGGTTTTAGGCACGACAGCAGGCTTGTGCGGCGCA |
Internal bar code: | TTGAATTATCTGATGTGGCCTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1850 |
LEAP-Seq percent confirming: | 57.1429 |
LEAP-Seq n confirming: | 8 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAAGTTGCTTCACTTCCCGC |
Suggested primer 2: | ATGAGAAGGAAAGGGCCAGC |