| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.044629 |
| Chromosome: | chromosome 12 |
| Location: | 2892328 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g502750 | PFD6 | Prefoldin alpha subunit; (1 of 1) K04798 - prefoldin beta subunit (pfdB, PFDN6) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCGCCCGCAATACCTGGAGTACCTGCTGACCCCCCCCCCCCCCGCCCG |
| Internal bar code: | ATTAGCGTGACACGGGCTCTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3689 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGTCCAAAAGTCGCCCTCT |
| Suggested primer 2: | CCAAGCCCTCAACATCCCAT |