Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.044668 |
Chromosome: | chromosome 12 |
Location: | 9403034 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g541350 | (1 of 14) PF00566 - Rab-GTPase-TBC domain (RabGAP-TBC) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGTATGTGTTGTTGAACATAACCCGCGGCCCCATACGCCCCACGCCCT |
Internal bar code: | TCTTCAACCAAGACAATGCAGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 358 |
LEAP-Seq percent confirming: | 78.9474 |
LEAP-Seq n confirming: | 15 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACACACACACACACGTCCTT |
Suggested primer 2: | GCAACCGCAACGATGAATCA |