Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.044692 |
Chromosome: | chromosome 3 |
Location: | 4991260 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g179550 | TF2H2 | (1 of 1) K03142 - transcription initiation factor TFIIH subunit 2 (TFIIH2, GTF2H2, SSL1); Transcription factor TFIIH, 44 kDa subunit | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCTTCTAAACCTCTTCAGCTCTCACCGCCCCTCGGCGCCGTCCTCCCCT |
Internal bar code: | CCCGCGACATAGGGTTTTCGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1932 |
LEAP-Seq percent confirming: | 83.3333 |
LEAP-Seq n confirming: | 10 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATAAACTCCCTCCCTCCCCC |
Suggested primer 2: | AGAGACGACCTCGGGATTGA |