| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.044692 |
| Chromosome: | chromosome 3 |
| Location: | 4991260 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g179550 | TF2H2 | (1 of 1) K03142 - transcription initiation factor TFIIH subunit 2 (TFIIH2, GTF2H2, SSL1); Transcription factor TFIIH, 44 kDa subunit | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCTTCTAAACCTCTTCAGCTCTCACCGCCCCTCGGCGCCGTCCTCCCCT |
| Internal bar code: | CCCGCGACATAGGGTTTTCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1932 |
| LEAP-Seq percent confirming: | 83.3333 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATAAACTCCCTCCCTCCCCC |
| Suggested primer 2: | AGAGACGACCTCGGGATTGA |