| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.044720 |
| Chromosome: | chromosome 13 |
| Location: | 2068160 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g576950 | (1 of 2) PTHR13690//PTHR13690:SF71 - FAMILY NOT NAMED // PROTEIN C37C3.9 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCCCACAACCCCGTCGCCAGGGACGCCGCCCAGCCCACCCCGTCCACC |
| Internal bar code: | AGACTTTAAAAATCCAGAGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 89 |
| LEAP-Seq percent confirming: | 45.4545 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTGCGTGCCAGTAGTTGAT |
| Suggested primer 2: | CTCATGCAGGTCGTTCTGGT |