| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.044736 |
| Chromosome: | chromosome 2 |
| Location: | 1136521 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g080850 | CYN47,CYN11 | Cyclophilin 47; (1 of 1) IPR003582//IPR029000 - ShKT domain // Cyclophilin-like domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCACCCCAACACGCCTGCCCCGCCTCCTGCCGCGTGGCACTGGAGTCT |
| Internal bar code: | TCGGCAAAGCCGCGCGAGTTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 952 |
| LEAP-Seq percent confirming: | 92.8571 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAACGTGCGTGTTGCTTCT |
| Suggested primer 2: | AACTGTGGACGGCTGCATTA |