| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.044824 |
| Chromosome: | chromosome 17 |
| Location: | 3921399 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g727900 | CRC1 | (1 of 68) 2.1.1.43 - Histone-lysine N-methyltransferase / Protein-lysine N-methyltransferase; Centrin-related calmodulin | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTAGCGGCTGCTGCTGCAACGGTGCCATAGGCGTCGGGGAGCGACGGG |
| Internal bar code: | GCGACGGTCGCAGACGTTGGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1594 |
| LEAP-Seq percent confirming: | 88.0 |
| LEAP-Seq n confirming: | 22 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATCATGCAGCGTGCTCTTC |
| Suggested primer 2: | CAATGCTGGTTTCGGGTGTG |