Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.044866 |
Chromosome: | chromosome 14 |
Location: | 648377 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g612150 | MOT18,PAP10 | Class-II RNA nucleotidyl transferase 10; (1 of 1) K14079 - poly(A) RNA polymerase GLD2 [EC:2.7.7.19] (PAPD4, GLD2) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCACCACCACTGCCACCAGCTCCAGCCCCAACCGCCACCGCAACCACC |
Internal bar code: | GTTATGGGTTCTCGCAATCTAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 346 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 6 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGTGGAAGAAGTGCGTAGGC |
Suggested primer 2: | TAGAGAGCCGTCAACCCTGA |