Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.044871 |
Chromosome: | chromosome 6 |
Location: | 2016236 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g265400 | HTB42,HTB12,HTB11 | (1 of 27) K11252 - histone H2B (H2B); Histone H2B | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCTTGGCAGGGGCCTCGGCGCCGGCCTCGGCGGTCGCGGGCTTCTCGTC |
Internal bar code: | GAGCAGTTATTAATCGTTATAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2325 |
LEAP-Seq percent confirming: | 51.1628 |
LEAP-Seq n confirming: | 22 |
LEAP-Seq n nonconfirming: | 21 |
LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGCCATTGTGTTGGGTTGG |
Suggested primer 2: | CTCAGTACTCGCTAGTGCCG |